Oligonucleotides
Oligonucleotides are required but not provided in the Illumina kits. The following oligonucleotide additive primers and associated index primers are provided as an example for common SNT use cases. Assess compatibility and order unique oligonucleotides for your specific needs.
Use the suggested oligonucleotide sequences to amplify the bead-bound cDNA that are generated from the captured SNTs. Alternatively, you can use the oligonucleotide sequences to generate sequencing-ready libraries with the Illumina Single Cell 3′ RNA kits. To amplify cDNA complementary to the SNTs, the additive primers are added to the PCR amplification reaction.
When generating sequencing-ready libraries with the amplified SNT cDNA, you must use specific additive primer-index combinations based on the application of interest. If using SNTs compatible with Additive Primer A, use P7 index A. If using SNTs compatible with Additive Primer H, use P7 index H. P5 index A/H is the same when using either SNTs compatible with Additive Primer A or H. You can also use SNTs compatible with both Additive Primer A and H in a single experiment. In this case, include both additive primers at the appropriate step in the enrichment protocol. Then, in library preparation, the A and H fragment libraries are amplified individually with the respective index primers.
Illumina recommends ordering primers from an oligonucleotide provider such as Integrated DNA Technologies. Order DNA oligonucleotide primers at 100 nmol scale with desalted purification. If preferred, you can order primers resuspended to a stock concentration of 100 µM in 1X IDTE Buffer. If you order lyophilized primers, upon receipt resuspend the primers to a stock concentration of 100 µM in 1X IDTE Buffer. Refer to the following table for final working stock concentrations for 1X IDTE Buffer:
Name |
Sequence (5′-3′) |
Working Concentration (µM) |
---|---|---|
WTA-F-V2 |
CTCTTTCCCTACACGACGCTC |
20 |
Additive Primer A |
CCTTGGCACCCGAGAATTCC |
10 |
Additive Primer H |
GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT |
10 |
P7 Index A for use with Additive Primer A |
CAAGCAGAAGACGGCATACGAGATXXXXXXXXXXGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA |
10 |
P7 Index H for use with Additive Primer H |
CAAGCAGAAGACGGCATACGAGATXXXXXXXXXXGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT |
10 |
Universal P5 Index for use with Additive Primer A or H |
AATGATACGGCGACCACCGAGATCTACACXXXXXXXXXXACACTCTTTCCCTACACGACGC |
10 |
Refer to Illumina Adapter Sequences for example index sequences for P7 Index A, P7 Index H, and universal P5 Index for A or H.
When ordering, include phosphorothioate internucleoside linkers, commonly coded as asterisks, between the last three base pairs of primers.
You must use customer-sourced P5 and P7 primers at the recommended working concentrations for the library preparation of SNT libraries. Do not use index primers provided with the Illumina Single Cell 3′ RNA kit or the Illumina Single Cell Unique Dual Indexes to amplify SNT libraries. These index primers do not contain the correct PCR handle.