Oligonucleotides
Oligonucleotides are required but not provided in the Illumina kits. The following oligonucleotide sequences are examples of common CROPseq sgRNA use cases. Assess compatibility and order unique oligonucleotides for their specific needs.
Use the suggested oligonucleotide sequences to amplify the bead-bound cDNA that are generated from the captured sgRNAs. Alternatively, you can use the oligonucleotide sequences to generate sequencing-ready libraries for Illumina sequencing with Illumina Single Cell 3′ RNA kits. To amplify cDNA complementary to the sgRNAs, an sgRNA-specific reverse primer is added to the PCR amplification reaction alongside the standard WTA-v2F forward primer.
Illumina recommends ordering primers from an oligonucleotide provider such as Integrated DNA Technologies. Order DNA oligonucleotide primers at 100 nmol scale with desalted purification. If preferred, you can order primers resuspended to a stock concentration of 100 µM in 1X IDTE Buffer. If you order lyophilized primers, upon receipt resuspend the primers to a stock concentration of 100 µM in 1X IDTE Buffer. Refer to the following table for final working stock concentrations for 1X IDTE Buffer:
Name |
Sequence (5′-3′) |
Working Concentration (µM) |
---|---|---|
WTA-V2-F |
CTCTTTCCCTACACGACGCTC |
40 |
PE2-sgRNA-R |
GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGTGTTT TGAGACTATAAGTATCCCTTGGAGAACCACCTTGTTG |
40 |
Refer to the following table for a suitable sgRNA construct example:
Construct |
Sequence (5′-3′) |
---|---|
sgRNA |
GTGTTTTGAGACTATAAGTATCCCTTGGAGAACCACCTTGTTGGACCAGGATGGGCACCAC CCGTTTAAGAGCTAAGCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACT TGAAAAAGTGGCACCGAGTCGGTGCAAAAAAAA (rpt) |
The reverse primer used during sgRNA Amplification (PE2_U6_Rev) is:
PE2 Nextera–U6 site
5′GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGTGTTTTGAGACTATAAGTATCCCTTGGAGAACCACCTTGTTG 3′
You can use the Illumina Single Cell Unique Dual Indexes plate for sgRNA library preparation, except when modifications are made to the PE2 Nextera–U6 site reverse primer sequence, in which case you must order custom unique dual indexes.
When ordering, include phosphorothioate internucleotide linkers, commonly coded as asterisks, between the last three base pairs of primers.