IDT for Illumina UD Indexes

The IDT for Illumina Unique Dual (UD) index adapters are arranged in the plate to enforce the recommended pairing strategy. The index adapters are 10 bases long, instead of the typical eight bases.

The IDT for Illumina UD Indexes include the following:

• IDT for Illumina DNA/RNA UD Indexes
• IDT for Illumina PCR UD Indexes
• IDT for Illumina Nextera DNA UD Indexes

Index 1 (i7) Adapters

CAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGCTCGG

Index 2 (i5) Adapters

AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC