Illumina Unique Dual Indexes

The Illumina Unique Dual (UD) index adapters are arranged in the plate to enforce the recommended pairing strategy. The index adapters are 10 bases long, instead of the typical eight bases.

The Illumina Unique Dual Indexes include the following:

Illumina DNA/RNA UD Indexes, Tagmentation
Illumina RNA UD Indexes, Ligation
Illumina Unique Dual Indexes, LT

Index 1 (i7) Adapters

CAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGCTCGG

Index 2 (i5) Adapters

AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC