Sample Sheet Requirements
The DRAGEN TruSight Oncology 500 ctDNA Local Analysis Software requires a sample sheet for each analysis. The sample sheet consists of a list of samples and their index sequences. Different types of sequencing runs use different index adapters.
Use Illumina Cloud Run Planning on BaseSpace Sequence Hub to generate a sample sheet specifically for your TSO 500 ctDNA run. Alternatively, use the index IDs available on the Illumina support site and delete index IDs you do not require.
The analysis fails if the sample sheet criteria are not met.
Create a DRAGEN TruSight Oncology 500 ctDNA-compatible sample sheet as follows.
v2 assay
Different bioinformatic baselines are applied depending on the indexes used. v1 baselines are applied when
| 1. | Save the sample sheet with the name SampleSheet.csv in the sequencing run folder. |
| 2. | In the Header section, enter the following parameter: |
| • | FileFormatVersion—2. |
| 3. | In the Reads section, enter the following parameters: |
| • | Read1Cycles—151 |
| • | Read2Cycles—151 |
| • | Index1Cycles—10 |
| • | Index2Cycles—10 |
| 4. | In the TSO500L_Settings section, enter the following parameters: |
| • | AdapterRead1—CTGTCTCTTATACACATCT |
| • | AdapterRead2—CTGTCTCTTATACACATCT |
| • | AdapterBehavior—trim |
| • | MinimumTrimmedReadLength—35 |
| • | MaskShortReads—35 |
| • | OverrideCycles—U7N1Y143;I10;I10;U7N1Y143 |
| 5. | In the TSO500L_Data section, enter the following parameters: |
|
Sample Parameter |
Required |
Details |
|||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
|
Sample_ID |
Yes |
The Sample_ID becomes a part of output file names. Sample IDs are not case-sensitive. Enter a sample ID with the following characteristics:
|
|||||||||
|
index |
Yes |
Index 1 sequence. |
|||||||||
|
index2 |
Yes |
Index 2 sequence. |
|||||||||
|
Sample_Type |
Yes |
Enter DNA for each sample. |
|||||||||
|
Lane |
No |
Required if you are using the XP workflow and an index pair is used for more than one sample. Use the lane column to specify the sample location per lane. You must specify a lane for each sample. If a sample is in multiple lanes, you must use multiple rows for each sample (one row per lane). |
|||||||||
|
I7_Index_ID |
Yes |
I7 index ID. |
|||||||||
|
I5_Index_ID |
Yes |
I5 index ID. |
|||||||||
|
Index_ID |
No |
Index set ID. |
|||||||||
|
Sample_Name |
No |
Name of the sample. |
| 6. | When starting analysis from BCL files, you must include the BCLConvert_Settings section with the following parameters. The values for each of these parameters should match the parameters in the TSO500L_Settings section in step 4. |
| • | AdapterRead1—CTGTCTCTTATACACATCT |
| • | AdapterRead2—CTGTCTCTTATACACATCT |
| • | AdapterBehavior—trim |
| • | MinimumTrimmedReadLength—35 |
| • | MaskShortReads—35 |
| • | OverrideCycles—U7N1Y143;I10;I10;U7N1Y143 |
| • | SoftwareVersion—3.10.9. |
| 7. | When starting analysis from BCL files, you must include the BCLConvert_Data section with only the following parameters. The values for each of these parameters should match the parameters in the TSO500L_Data section. |
| • | Sample_ID |
| • | Index |
| • | Index2 |
| • | [Optional] Lane |
v1 assay
Different bioinformatic baselines are applied depending on the indexes used. v1 baselines are applied when UP indexes are used and v2 baselines are applied when UDP indexes are used.
| 1. | Save the sample sheet with the name SampleSheet.csv in the sequencing run folder. |
| 2. | In the Header section, enter the following parameter: |
| • | FileFormatVersion—2. |
| 3. | In the Reads section, enter the following parameters: |
| • | Read1Cycles—151 |
| • | Read2Cycles—151 |
| • | Index1Cycles—8 |
| • | Index2Cycles—8 |
| 4. | In the TSO500L_Settings section, enter the following parameters: |
| • | AdapterRead1—AGATCGGAAGAGCACACGTCTGAACTCCAGTCA |
| • | AdapterRead2—AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT |
| • | AdapterBehavior—trim |
| • | MinimumTrimmedReadLength—35 |
| • | MaskShortReads—35 |
| • | OverrideCycles—U7N1Y143;I8;I8;U7N1Y143. |
| 5. | In the TSO500L_Data section, enter the following parameters. |
|
Sample Parameter |
Required |
Details |
|||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
|
Sample_ID |
Yes |
The Sample_ID becomes a part of output file names. Sample IDs are not case-sensitive. Enter a sample ID with the following characteristics:
|
|||||||||
|
index |
Yes |
Index 1 sequence. |
|||||||||
|
index2 |
Yes |
Index 2 sequence. |
|||||||||
|
Sample_Type |
Yes |
Enter DNA for each sample. |
|||||||||
|
Lane |
No |
Required if you are using the XP workflow and an index pair is used for more than one sample. Use the lane column to specify the sample location per lane. You must specify a lane for each sample. If a sample is in multiple lanes, you must use multiple rows for each sample (one row per lane). |
|||||||||
|
I7_Index_ID |
Yes |
I7 index ID. |
|||||||||
|
I5_Index_ID |
Yes |
I5 index ID. |
|||||||||
|
Index_ID |
No |
Index set ID. |
|||||||||
|
Sample_Name |
No |
Name of the sample. |
| 6. | When starting analysis from BCL files, you must include the BCLConvert_Settings section with the following parameters. The values for each of these parameters should match the parameters in the TSO500L_Settings section in step 4. |
| • | AdapterRead1—AGATCGGAAGAGCACACGTCTGAACTCCAGTCA |
| • | AdapterRead2—AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT |
| • | AdapterBehavior—trim |
| • | MinimumTrimmedReadLength—35 |
| • | MaskShortReads—35 |
| • | OverrideCycles—U7N1Y143;I8;I8;U7N1Y143 |
| • | SoftwareVersion—3.10.9. |
| 7. | When starting analysis from BCL files, you must include the BCLConvert_Data section with only the following parameters. The values for each of these parameters should match the parameters in the TSO500L_Data section. |
| • | Sample_ID |
| • | Index |
| • | Index2 |
| • | [Optional] Lane |
