Sample Sheet Requirements

A DRAGEN TruSight Oncology 500 Analysis Software sample sheet is required for each analysis. The sample sheet is a comma-separated values file (*.csv) that contains information to set up and analyze a sequencing run. The DRAGEN TruSight Oncology 500 Analysis Software supports sample sheet v2.

Compatible sample sheet templates are provided in the resource file folder that is installed with the software.

The sample sheet is made up of a list of samples and their index sequences, along with optional sample information. DNA samples enriched using TruSight Oncology 500 HRD must be indicated in the Sample Feature column of the sample sheet. Different types of sequencing runs may use different index adapters. Use the index IDs included in the DRAGEN TruSight Oncology 500 Analysis Software resource bundle.

The analysis fails if the sample sheet criteria are not met.

Use the following steps to create a TruSight Oncology 500 sample sheet.

1. Download the v2 sample sheet template from the resource bundle installed with the software: /staging/illumina/DRAGEN_TSO500/resources/sampleSheet/.
2. In the BCL Convert Settings section, enter the following required parameters:

Sample Parameter

Required

Details

SoftwareVersion

Yes

Enter 3.10.9.

AdapterRead1

Yes

If using 8 bp indexes starting with UP or CP (used with TSO 500):

AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

If using 10 bp indexes with UDP (used with TSO 500 HT):

CTGTCTCTTATACACATCTCCGAGCCCACGAGAC

Analysis fails if the incorrect adapter sequences are used.

AdapterRead2

Yes

If using 8 bp indexes starting with UP or CP (used with TSO 500):

AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

If using 10 bp indexes with UDP (used with TSO 500 HT):

CTGTCTCTTATACACATCTGACGCTGCCGACGA

Analysis fails if the incorrect adapter sequences are used.

AdapterBehavior

Yes

Enter trim. This indicates that the BCL Convert software trims the specified adapter sequences from each read.

MinimumTrimmedReadLength

Yes

Enter 35. Reads with a length trimmed below this point are masked.

MaskShortReads

Yes

Enter 35. Reads with a length trimmed below this point are masked.
3. In the BCL Convert Data section, enter the following parameters for each sample.

Sample Parameter

Required

Details

Sample_ID

Yes

Must match a Sample_ID listed in the [TSO500S_Data] section.

Index

Yes

Index 1 sequence valid for Index_ID assigned to matching Sample_ID in the [TSO500S_Data] section.

Index2

Yes

Index 2 sequence valid for Index_ID assigned to matching Sample_ID in the [TSO500S_Data] section.

Lane

Only for NovaSeq 6000 XP or NovaSeq 6000Dx (RUO) workflows

Indicates which lane corresponds to a given sample. Enter a single numeric value per row. Where lane value is specified, Index IDs provided must be unique per lane.

Cannot be empty if a header is present. The analysis fails if the Lane column is present without any values.
4. In the TSO 500 Data section, enter the following parameters for each sample.

Sample Parameter

Required

Details

Sample_ID

Yes

The unique ID to identify a sample. The sample ID is included in the output file names. Sample IDs are not case sensitive. Sample IDs must have the following characteristics:

• Unique for the run.
• 1–40 characters.
• No spaces.
• Alphanumeric characters with underscores and dashes. If you use an underscore or dash, enter an alphanumeric character before and after the underscore or dash. eg, Sample1-T5B1_022515.
• Cannot be called all, default, none, unknown, undetermined, stats, or reports.
• Must match a Sample_ID listed in the [TSO500S_Data] section.
• Illumina recommends that the sample ID be based on the pair ID. Example: <PairID>-DNA,<PairID>-RNA.
• Each sample must have a unique combination of Lane (if applicable), sample ID, and index ID or the analysis will fail.

Index_ID

Yes

The index ID used for the sample. Must be unique per sample unless samples are assigned different lanes.

Mismatches between the samples and index primers can cause incorrect result reporting due to loss of positive sample identification. Enter sample IDs and assign indexes in the sample sheet before beginning library preparation.

Valid indexes for DNA samples are:

• UP1–UP16
• CP1–CP16
• UDP0001–UDP0192 (Used with TSO 500 HT)

Valid Indexes for RNA Samples are:

• UP1–UP16
• UDP0001–UDP0192 (Used with TSO 500 HT)

Use the appropriate Index ID for the assay. Refer to AdapterRead1 and AdapterRead2 for the correct adapter ready sequence for Index ID.

Sample_Type

Yes

Enter DNA or RNA.

For HRD samples, this parameter must be DNA.

Pair_ID

Yes

A unique ID that links DNA and RNA from the same biological sample from the same individual. Pair ID shares, at most, one DNA and one RNA sample per run. eg, if a Sample_ID is TestSample1-DNA for DNA and TestSample1-RNA for RNA, the Pair_ID TestSample1 will link these samples that are on different rows in the sample sheet together.

If the pair ID is associated with more than one DNA or RNA sample, the analysis fails.

Sample_Feature

No

Only required for HRD enriched samples.

For DNA samples that have undergone HRD enrichment, enter HRD in this column of the sample sheet. If the sample has not undergone HRD enrichment, leave the field empty.

Sample_Description

No

Sample description must meet the following requirements:

• 1–50 characters.
• Alphanumeric characters with underscores, dashes and spaces. If you enter a underscore, dash, or space, enter an alphanumeric character before and after. eg, Solide-FFPE_213.
5. Make sure the sample sheet does not contain any blank lines at the bottom. The lines cause the analysis to fail.
6. Save the sample sheet in the sequencing run folder using one of the following methods:
• Save the sample sheet with the name SampleSheet.csv.
• Name the sample sheet with the name of your choice and specify the path to the sample sheet in the command-line options.