Sample Sheet
A sample sheet (SampleSheet.csv) records information about samples, the corresponding indexes, and other information that dictates the behavior of DRAGEN. The default location of the sample sheet is the root output folder. To specify any CSV file in any location, use the command --sample-sheet. When a sample sheet does not exist in the default location and no sample sheet is specified in the command line, DRAGEN produces an error.
In addition to the command line options that control the behavior of BCL conversion, use the [Settings] section in the sample sheet configuration file to specify how the samples are processed. The following are the sample sheet settings for BCL conversion.

DRAGEN supports both sample sheets v1 and v2. The following table displays the different supported options for v1 and v2.
Sample Sheet v1 |
Sample Sheet v2 |
---|---|
Supports both [Settings] and [settings]. Neither are required. |
Supports only [BCLConvert_Settings]. Required. |
Unrecognized settings trigger a warning. |
Unrecognized settings produce an error and analysis aborts. |

In addition to the command line options that control the behavior of BCL conversion, you can use the [Settings] section in the sample sheet configuration file to specify how the samples are processed. The following are the sample sheet settings for BCL conversion.
DRAGEN does not support the following sample sheet settings from bcl2fastq:
• | FindAdapterWithIndels |
• | ReverseComplement |
Setting |
Default |
Value |
Description |
|||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|
AdapterBehavior |
trim |
trim, mask |
Defines whether DRAGEN masks or trims Read 1 and/or Read 2 adapter sequence(s). When AdapterRead1 or AdapterRead2 is not specified, this setting cannot be specified.
|
|||||||||
AdapterRead1 |
Not applicable |
Read 1 adapter sequence containing A, C, G, or T. |
The sequence of the Read 1 adapter to be masked or trimmed. To trim multiple adapters, separate the sequences with a plus sign (+) to indicate independent adapters that must be independently assessed for masking or trimming for each read. Allowed characters: A, T, C, G. |
|||||||||
AdapterRead2 |
Not applicable |
Read 2 adapter sequence containing A, C, G, or T. |
The sequence of the Read 2 adapter to be masked or trimmed. To trim multiple adapters, separate the sequences with a plus sign (+) to indicate independent adapters that must be independently assessed for masking or trimming for each read. Allowed characters: A, T, C, G. |
|||||||||
AdapterStringency |
0.9 |
Float between 0.5 and 1.0 |
The minimum match rate that triggers masking or trimming. This value is calculated as MatchCount / (MatchCount+MismatchCount). Accepted values are 0.5–1. The default value of 0.9 indicates that only reads with ≥ 90% sequence identity with the adapter are trimmed. |
|||||||||
MinimumAdapterOverlap |
1 |
1, 2, or 3 |
Do not trim any bases unless the adapter matches are greater than or equal to the number of bases specified. At least one AdapterRead1 or AdapterRead2 must be specified to use MinimumAdapterOverlap. Allowed characters: 1, 2, 3. |
|||||||||
MaskShortReads |
The minimum of 22 and MinimumTrimmedReadLength. |
0 to MinimumTrimmedReadLength |
Reads trimmed below this point become masked out. |
|||||||||
OverrideCycles |
None |
Y: Specifies a sequencing read I: Specifies an indexing read U: Specifies a UMI length to be trimmed from read |
String used to specify UMI cycles and mask out cycles of a read. |
|||||||||
TrimUMI |
1 |
0 or 1 |
If set to 0, UMI sequences are not trimmed from output FASTQ reads. The UMI is still placed in sequence header. |
|||||||||
CreateFastqForIndexReads |
0 |
0 or 1 |
If set to 1, output FASTQ files for index reads as well as genomic reads. |
|||||||||
NoLaneSplitting |
false |
true or false |
If set to true, output all lanes of a flow cell to the same FASTQ files consecutively. |
|||||||||
FastqCompressionFormat |
gzip |
gzip, dragen, dragen-interleaved |
Beta feature, compress BCL files:
|

The OverrideCycles mask elements are semicolon separated. For example:
OverrideCycles,U7N1Y143;I8;I8;U7N1Y143
DRAGEN supports flexible UMI processing during BCL conversion to support more third-party assays, including UMI sequences in index reads and multiple UMI regions per read. UMI sequences are trimmed from FASTQ read sequences and placed in the sequence identifier for each read, as normal.
The following are examples of OverrideCycles settings using 2x151 reads:
Setting |
Description |
|||||||||
---|---|---|---|---|---|---|---|---|---|---|
OverrideCycles,U7N1Y143;I8;I8;U7N1Y143 |
UMI is composed of the first 7 bp of each genomic read, linked by 1 bp of ignored sequence, and is the format for Illumina nonrandom UMIs, used in the following products:
|
|||||||||
OverrideCycles,Y151;I8;U10;Y151 |
Index Read 2 is a 10 bp UMI, and is the format for Agilent XT HS. |
|||||||||
OverrideCycles,Y151;I8U9;I8;Y151 |
Index Read 1 contains both an index and a 9 bp UMI, and is the format for IDT Dual Index Adapters with UMIs. |
|||||||||
OverrideCycles,U3N2Y146;I8;I8;U3N2Y146 |
UMI is composed of the first 3 bp of each genomic read, linked by 2 bp of ignored sequence, and is the format for UMIs in SureSelect XT HS 2 and IDT xGen Duplex Seq Adapter. |
|||||||||
OverrideCycles,Y151;I8;I8;U10N12Y127 |
UMI is at the beginning of Read 2, attached with a linker sequence of length 12. |

When using --no-lane-splitting true or the corresponding sample sheet setting NoLaneSplitting-true, DRAGEN FASTQ file name convention and FASTQ contents match bcl2fastq2 for the same feature.
DRAGEN only supports this mode when the Lanecolumn is specified in the sample sheet to make sure that all samples are present in all lanes in the same order listed. This order is expected for flow cells with no fluidic boundaries between lanes.

The data section is required. Headers for the data section should be [Data] or [data] for sample sheet v1 and [BCLConvert_Data] for sample sheet v2. DRAGEN uses columns in the Data section to sort samples and index adapters.
Column |
Description |
---|---|
Lane |
When specified, DRAGEN generates FASTQ files only for the samples with the specified lane number. Only one valid integer is allowed, as defined by the RunInfo.xml. |
Sample_ID |
The sample ID. |
index |
The Index 1 (i7) index adapter sequence. |
index2 |
The Index 2 (i5) Index adapter sequence. |
Sample_Project |
Can only contain alphanumeric characters, dashes, and underscores. Duplicate data strings with different cases (eg, sampleProject and SampleProject) are not allowed. If these data strings are used, analysis fails. This column is not used unless you are using the command line option --bcl-sampleproject-subdirectories. See Command Line Options for more information on command line options. |

DRAGEN does not support the following settings, and new formats must replace their corresponding old formats, when applicable. Manual changes to the sample sheet can be made to the [Settings] section, but the [Data] section must remain unchanged. If any of the obsolete settings are used in the command line or the sample sheet, DRAGEN aborts and returns an error. Also note that some obsolete settings that were previously specified on the command line are now correctly specified in the sample sheet.
Behavior |
Obsolete Settings |
New Settings |
---|---|---|
Designate the adapter sequences for Read 1 and Read 2 and specify the behavior as trim. |
(sample sheet) Adapter, AGATCGGAAGAGCACACGTCTGAACTCCAGTCA OR TrimAdapter, AGATCGGAAGAGCACACGTCTGAACTCCAGTCA |
(sample sheet) AdapterRead1, AGATCGGAAGAGCACACGTCTGAACTCCAGTCA AND AdapterRead2, AGATCGGAAGAGCACACGTCTGAACTCCAGTCA |
Designate the same adapter sequence for Read 1 and Read 2 and specify the behavior as mask. |
(sample sheet) MaskAdapter, AGATCGGAAGAGCACACGTCTGAACTCCAGTCA |
(sample sheet) AdapterRead1, AGATCGGAAGAGCACACGTCTGAACTCCAGTCA AND AdapterRead2, AGATCGGAAGAGCACACGTCTGAACTCCAGTCA AND AdapterBehavior, mask |
Designate the adapter sequences for Read 1 and Read 2 and specify the behavior as mask. |
(sample sheet) MaskAdapter, AGATCGGAAGAGCACACGTCTGAACTCCAGTCA OR MaskAdapterRead2, AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT |
(sample sheet) AdapterRead1, AGATCGGAAGAGCACACGTCTGAACTCCAGTCA AND AdapterRead2, AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT AND AdapterBehavior, mask |
Designate the adapter sequences for Read 1 and Read 2 and specify the behavior as trim. Also specify 0.5 as the adapter stringency. |
(sample sheet) Adapter, AGATCGGAAGAGCACACGTCTGAACTCCAGTCA OR TrimAdapter, AGATCGGAAGAGCACACGTCTGAACTCCAGTCA (command line) --adapter-stringency 0.5 |
(sample sheet) AdapterRead1, AGATCGGAAGAGCACACGTCTGAACTCCAGTCA AND AdapterRead2, AGATCGGAAGAGCACACGTCTGAACTCCAGTCA(sample sheet) AND AdapterStringency, 0.5 |
Behavior |
Obsolete Settings |
New Settings |
---|---|---|
Trim the first 7 bases and last 6 bases of Read 1 for a 151 x 8 x 8 x 151 run. |
(sample sheet) Read1StartFromCycle, 8 Read1EndWithCycle, 145 |
(sample sheet) N7Y137N6;I8;I8;Y151 |
|
Obsolete Settings |
New Settings |
---|---|---|
Designate the first 8 cycles of Read 1 and Read 2 as UMIs and trim the trailing base for a 151 x 8 x 8 x 151 run. |
(sample sheet) Read1UMIStartFromCycle, 1 Read1UMILength, 8 Read1StartFromCycle, 10 Read2UMIStartFromCycle, 1 Read2UMILength, 8 Read2StartFromCycle, 10 |
(sample sheet) U8N1Y142;I8;I8;U8N1Y142 |
Behavior |
Obsolete Command Line Settings |
New Sample Sheet Settings |
---|---|---|
Allow 1 mismatch in the i7 index sequence and 1 mismatch i5 index sequence. |
--barcode-mismatches 1 OR --barcode-mismatches 1,1 |
BarcodeMismatchesIndex1, 1 AND BarcodeMismatchesIndex2, 1 |
Allow 2 mismatches in the i7 index sequence and 2 mismatches in the i5 index sequence. |
--barcode-mismatches 2 OR --barcode-mismatches 2,2 |
BarcodeMismatchesIndex1, 2 AND BarcodeMismatchesIndex2, 2 |
Behavior |
Obsolete Command Line Settings |
New Sample Sheet Settings |
---|---|---|
Make sure that all trimmed reads are at least 10 base pairs long after adapter trimming by appending Ns to any read shorter than 10 base pairs. |
--minimium-trimmed-read-length 10 |
MinimumTrimmedReadLength, 10 |
Make sure that all trimmed reads below 5 base pairs long are masked with Ns. |
--mask-short-adapter-reads, 5 |
MaskShortReads, 5 |